editingLogo

There are 215 fly miRNA:lncRNA interactions which can be impacted by editing sites.

miRNA ID Accession pre-miRNA Chromosome Strand Start End Matrue Sequence
dme-miR-375-3p MIMAT0005472 dme-mir-375 chr2L + 857596 857617 UUUGUUCGUUUGGCUUAAGUUA
dme-miR-2280-5p MIMAT0011786 dme-mir-2280 chr2L - 1831749 1831770 UCUUAGCUUGGCAAUAAAAUAU
dme-miR-4972-3p MIMAT0020200 dme-mir-4972 chr2L - 3636992 3637013 UAUAUCUGUGCGAUCGGGAUUG
dme-miR-4972-5p MIMAT0020199 dme-mir-4972 chr2L - 3637028 3637049 CCUCGGCUUUACAGAUAUAUAU
dme-miR-1004-3p MIMAT0005017 dme-mir-1004 chr2L + 3767667 3767688 UCUCACAUCACUUCCCUCACAG
dme-miR-4910-5p MIMAT0020503 dme-mir-4910 chr2L - 4817861 4817881 GUUUGUAUGGAAUUCCAUGAG
dme-miR-4912-5p MIMAT0020505 dme-mir-4912 chr2L - 4830017 4830039 GUGAGUAGUCGUAUGUUUAUUAA
dme-miR-2495-5p MIMAT0012204 dme-mir-2495 chr2L + 5068596 5068617 UGGCACUUCAAUUGGGCUGACU
dme-miR-2495-3p MIMAT0012205 dme-mir-2495 chr2L + 5068635 5068658 CGGCACCUAAUUGAAAUGCCCGCC
dme-miR-959-5p MIMAT0020854 dme-mir-959 chr2L + 5640959 5640979 UUAGUACUCGGGUUGAUAAAG
dme-miR-960-5p MIMAT0005474 dme-mir-960 chr2L + 5641081 5641102 UGAGUAUUCCAGAUUGCAUAGC
dme-miR-960-3p MIMAT0020855 dme-mir-960 chr2L + 5641119 5641140 UAUACGGUCUGGGACACUUUUA
dme-miR-961-5p MIMAT0005475 dme-mir-961 chr2L + 5641208 5641229 UUUGAUCACCAGUAACUGAGAU
dme-miR-962-3p MIMAT0020857 dme-mir-962 chr2L + 5641352 5641373 ACUUCAGUUUCAUUACCUUUCA
dme-miR-963-3p MIMAT0020858 dme-mir-963 chr2L + 5642043 5642064 AACAUCUGUAUAUACCUUUGUU
dme-miR-966-5p MIMAT0005481 dme-mir-966 chr2L - 6045678 6045698 UGUGGGUUGUGGGCUGUGUGG
dme-miR-932-5p MIMAT0005479 dme-mir-932 chr2L + 6902077 6902098 UCAAUUCCGUAGUGCAUUGCAG
dme-miR-932-3p MIMAT0020860 dme-mir-932 chr2L + 6902116 6902137 UGCAAGCGCUGCGGAUUUGGCA
dme-miR-275-3p MIMAT0000333 dme-mir-275 chr2L + 7425853 7425875 UCAGGUACCUGAAGUAGCGCGCG
dme-miR-305-5p MIMAT0000391 dme-mir-305 chr2L + 7425979 7426001 AUUGUACUUCAUCAGGUGCUCUG
dme-miR-4984-5p MIMAT0020219 dme-mir-4984 chr2L - 8141608 8141632 AGCGAAUACGCCUCGGAUCCAAUCA
dme-miR-2b-1-5p MIMAT0020782 dme-mir-2b-1 chr2L - 8258662 8258684 GUCUUCAAAGUGGCAGUGACAUG
dme-miR-87-5p MIMAT0020821 dme-mir-87 chr2L - 9950483 9950504 UCGCGCCUGUAUCUUGCUGAAC
dme-miR-4970-5p MIMAT0020197 dme-mir-4970 chr2L + 10741905 10741926 CUGGGAGCAGCAGUUGCUGGCG
dme-miR-4987-5p MIMAT0020225 dme-mir-4987 chr2L - 10840425 10840447 UUGCAACAGCGUGCGGCACGAUU
dme-miR-967-3p MIMAT0020863 dme-mir-967 chr2L - 12460014 12460036 CUUUUCCACCUAGGUGUCUCUCU
dme-miR-9382-3p MIMAT0035228 dme-mir-9382 chr2L + 12725003 12725024 AUCCCCGGCGCCACUGUGAUCG
dme-miR-2489-5p MIMAT0020910 dme-mir-2489 chr2L + 13609978 13610006 UAAGUUAGACGUGAGUAUGGCUAUACAAA
dme-miR-1002-3p MIMAT0020864 dme-mir-1002 chr2L - 13747621 13747642 GCAUUGUAUGACCUACUUAACU
dme-miR-1002-5p MIMAT0005483 dme-mir-1002 chr2L - 13747660 13747683 UUAAGUAGUGGAUACAAAGGGCGA